AciI from New England Biolabs

Product Specs
ItemAciI
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberR0551S
Quantity200 units
Concentration5 u/µL
ApplicationsDNA Manipulation
Brand/TrademarkNew England Biolabs Inc (NEB)
TypeRestriction Enzyme
Temperature-20 C

Sequence

C/CGC + G/CGG

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Eliminating Malaria Vectors with Precision Guided Sterile MalesbioRxivJuly 26, 2023Andrea L. Smidler, Reema A. Apte, James J. Pai, Martha L. Chow, Sanle Chen, Agastya Mondal, Héctor M. Sánchez C., Igor Antoshechkin, John M. Marshall, Omar S. Akbari1114A.S41 (5’ CGGAAAGTTTATCATCCACTCTGAC 3’) primers, and the amplicon was digested with Acil (NEB cat#R0551S). To identify mutations by gRNAfle.7, the fle locus was amplified with the 1154A.S23 (5’ CTCAGCAAGCAGTATGCCAAC

(2) Regionalized Protein Localization Domains in the Zebrafish Hair Cell KinociliumJournal of Developmental BiologyJune 16, 2023Timothy Erickson, William Paul Biggers, Kevin Williams, Shyanne E. Butland, Alexandra VenutoBeverly, MA, USA, 2302830), and performing a NaCl-isopropanol precipitation with glycogen (Thermo Fisher, R0551) acting as an inert carrier. Biotinylated RNA was fragmented to approximately 200–500 bases using the

(3) Toll-like receptor 2-mediated downstream cytokine levels as determinant of malaria pathogenesisIndian Journal of Medical ResearchJune 7, 2023Manash Pratim Kalita, Tarun Kumar Basumatary, Subhash Medhi, Ramie Husneara Begumagarose gel. The PCR products (14 µl) were then digested with the restriction enzyme AciI (Cat. No-R0551S, New England Biolabs, USA) at 37°C, incubated overnight, and were then analyzed based on band pattern

(4) Induced hepatic stem cells maintain self-renewal through the high expression of Myc coregulated by TET1 and CTCFCell & BioscienceSeptember 2, 2022Chen Wang, Xinlu Yu, Sai Ding, Yang Liu, Hongxia Zhang, Jingbo Fu, Bing Yu, Haiying Zhurestriction endonuclease-PCR (MSRE-PCR) The genomic DNA extracted from cells was digested with AciI (R0551 V, New England BioLabs) and HpaII (R0171 V, New England BioLab), respectively. Genomic DNA digested

(5) Recruitment of Scc2/4 to double-strand breaks depends on γH2A and DNA end resectionLife Science AllianceMay 1, 2022Martin Scherzer, Fosco Giordano, Maria Solé Ferran, Lena Strömwith 80% EtOH, and resuspended in 50 μl of TE. 10 μl of each sample were digested with 10 U of AciI (R0551S; New England Biolabs) and 10 U MseI (R0525S; New England Biolabs) in a total reaction volume of 30 μl

(6) Mistranslation Reduces Mutation Load in Evolving Proteins through Negative Epistasis with DNA MutationsMolecular Biology and EvolutionOctober 27, 2021Jia Zheng, Ning Guo, Andreas Wagner°C overnight. After that, we precipitated the ligation product by adding 80 µl ddH2O, 1 µl glycogen (R0551, Thermo Scientific), 50 µl 7.5 M ammonium acetate (A2706-100ML, Sigma), and 375 µl ice-cold absolute

(7) DNA methylation patterns in juvenile systemic sclerosis and localized sclerodermaClinical ImmunologyJuly 1, 2021Patrick Coit, Kaila L. Schollaert, Emily M. Mirizio, Kathryn S. Torok, Amr H. SawalhaTo confirm proper CpG methylation, 200ng of plasmids were double digested with AciI (5’-C/CGC-3’) (R0551S; New England BioLabs; Ipswich, MA, USA), which is blocked by methylated CpG sites, and SacI-HF (5’-GAGCT/C-3’)

(8) Cis-Repression of Foxq1 Expression Affects Foxf2-Mediated Gene Expression in Palate DevelopmentFrontiers in Cell and Developmental BiologyApril 8, 2021Jingyue Xu, Han Liu, Yu Lan, Rulang Jiangamplified from wildtype, Foxf2+/–, and Foxf2–/– cDNA samples were digested overnight using AciI (NEB, R0551L) at 37oC. Quantification of the digested and undigested DNA fragments was performed by QIAxcel Advanced

(9) DNA length tunes the fluidity of DNA-based condensatesBiophysical journalApril 6, 2021Muzzopappa F, Hertzog M, Erdel F.KpnI (NEB, R0142); 3) AatII (NEB, R0117), BamHI (NEB, R3136), and KpnI (NEB, R0142); or 4) AciI (NEB, R0551), HindIII (NEB, R0104), and DraI (NEB, R0129). The 1 kb and 5 kb fragments were generated by PCR using

(10) High-throughput genotyping assays for identification of glycophorin B deletion variants in population studiesExperimental Biology and MedicineApril 1, 2021Dominic SY Amuzu et al.and 3b, with primers purchased from IDT (Leuven, Belgium). Restriction enzymes AciI (Catalog number: R0551L, NEB, UK) and BsrBI (Catalog number: R0102L, NEB, UK) were purchased (Table 4a). Reactions were prepared

(11) Tetracyclines promote survival and fitness in mitochondrial disease modelsNature metabolismJanuary 1, 2021Perry EA, Bennett CF, Luo C, Balsa E, Jedrychowski M, O'Malley KE, Latorre-Muro P, Ladley RP, Reda K, Wright PM, et al.(New England Biolabs, R0114S) and ND1 and control cybrids were digested with Acil (New England Biolabs, R0551S). The reactions were incubated for 1 hour at 37°C and run on a 2% agarose gel. Oxygen consumption measurements. For

(12) Epigenome-wide base-resolution profiling of DNA methylation in chorionic villi of fetuses with Down syndrome by methyl-capture sequencingClinical EpigeneticsDecember 1, 2019Ji Hyae Lim, Yu-Jung Kang, Bom Yi Lee, You Jung Han, Jin Hoon Chung, Moon Young Kim, Min Hyoung Kim, Jin Woo Kim, Youl-Hee Cho, Hyun Mee Ryuincluded (normal DS = 5:4). DNA samples (10 ng) were treated with AciI (New England Biolabs, catalog no. R0551L) as the methylation-specific restriction enzyme (MSRE) according to the manufacturer’s instructions,

(13) Lead, Cadmium and Zinc Phytotoxicity Alter DNA Methylation Levels to Confer Heavy Metal Tolerance in WheatInternational Journal of Molecular SciencesSeptember 20, 2019Sarfraz Shafiq, Qudsia Zeb, Asim Ali, Yasar Sajjad, Rashid Nazir, Emilie Widemann, Liangyu Liumethod from wheat roots after 48 h of Pb, Cd and Zn treatments. Then the DNA was digested with AciI (R0551S New England Biolabs, Ipswich, MA, USA) and hpaII (R0171S New England Biolabs, Ipswich, MA, USA) for

(14) Kat2a and Kat2b Acetyltransferase Activity Regulates Craniofacial Cartilage and Bone Differentiation in Zebrafish and MiceJournal of Developmental BiologyNovember 12, 2018Rwik Sen, Sofia A. Pezoa, Lomeli Carpio Shull, Laura Hernandez-Lagunas, Lee A. Niswander, Kristin Bruk Artingerand (Rv) 50 -GCGTTTCTCAGGTGGTAGTT-30 , followed by digestion with AciI (New England BioLabs, Catalog# R0551L), yields a digested lower band for mutant, an undigested upper band for WT, and a combination of both

(15) Anosmin1 Shuttles Fgf to Facilitate Its Diffusion, Increase Its Local Concentration, and Induce Sensory OrgansDevelopmental CellSeptember 1, 2018John Wang, Yandong Yin, Stephanie Lau, Jagadish Sankaran, Eli Rothenberg, Thorsten Wohland, Martin Meier-Schellersheim, Holger Knaut,Thermo Fisher,A33082 BsrI,New England Biolabs,R0527S Hpych4v,New England Biolabs,R0620L AciI,New England Biolabs,R0551S ApoI,New England Biolabs,R0566L Taqαi,New England Biolabs,R0149L Brefeldin A,Sigma Aldrich,B7651–5MG Critical

(16) Comprehensive Whole DNA Methylome Analysis by Integrating MeDIP-seq and MRE-seqMethods in Molecular BiologyJune 11, 2018Xiaoyun Xing, Bo Zhang, Daofeng Li, Ting Wangenzymes for DNA digestion. HpaII (NEB; cat. no. R0171S).HinP1I (NEB; cat. no. R0124S).AciI (NEB; cat. no. R0551S).HpyCH4IV (NEB; cat. no. R0619S).Bsh1236I (Thermo Scientific; cat. no. ER0921). Gel electrophoresis

(17) Mutations Causing Slow-Channel Myasthenia Reveal That a Valine Ring in the Channel Pore of Muscle AChR is Optimized for Stabilizing Channel GatingHuman MutationOctober 1, 2016Xin-Ming Shen, Tatsuya Okuno, Margherita Milone, Kenji Otsuka, Koji Takahashi, Hirofumi Komaki, Elizabeth Giles, Kinji Ohno, Andrew G. Engel5′-ATCGTGCCCTGTGTGCTCATC-3′ on exon 7 and 5′-CCACCCAGCGTCCGAATAAA-3′ on intron 8 by PCR, and was digested with AciI (R0551, New England Biolabs). AciI digestion gave rise to two fragments of 53 and 45 bp from the mutant allele,

(18) Association of variants in BAFF (rs9514828 and rs1041569) and BAFF-R (rs61756766) genes with the risk of chronic lymphocytic leukemiaTumour biology : the journal of the International Society for Oncodevelopmental Biology and MedicineOctober 1, 2016Jasek M, Bojarska-Junak A, Wagner M, Sobczyński M, Wołowiec D, Roliński J, Karabon L, Kuśnierczyk P.of assays used in this study). The BAFF rs9514828 was examined by both RFLP [16] (AciI, catalog no. R0551, New England Biolabs® Inc., Ipswich, MA, USA) and TaqMan methods (assay ID C_29641742_10) or by double

(19) Sex differences in Gadd45b expression and methylation in the developing rodent amygdalaBrain ResearchJuly 1, 2016Stacey L. Kigar, Liza Chang, Margaret R. Hayne, Nicolette T. Karls, Anthony P. Augerrat was divided equally into two tubes and digested with either AciI (New England Biolabs; catalog #R0551) or ClaI (New England Biolabs; catalog #R0197) in the same buffer conditions at 37°C for 90 min. Enzymes

(20) Enucleation after fusion and activation enhances the development of reconstructed bovine embryosAnimal Reproduction ScienceDecember 12, 2011W.T.K. Cheng, B.T. Liu, H.Y. Su, J.W. Lee, C.H. Wang, S.N. Lee, F.H. Chu, D.W. Yang, L.R. Chen, P.C. Shen

Be the First to Write a Review!

AciI

AciI from New England Biolabs

Sequence

New England Biolabs

Citations (21)

Reviews

AciI from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map